DNA Amplification by PCR Lab Activity
In this investigation, students amplify various segments of the bacteriophage lambda genome, then electrophorese and analyze the PCR samples. Students use the sizes of the PCR products generated by the three different forward primers and one reverse primer, provided, to map the locations of the primers relative to one another in the bacteriophage lambda genome. You will get enough materials to run up to 24 PCR reactions, as well as a teacher’s guide and student copy-master.
Materials Included
•1 Sterile Mineral Oil, 5 mL
•1 Sterile Water, 5 mL
•1 TBE Running Buffer 5X, 500 mL
•1 Vial of Loading Dye, 0.5 mL
•1 Agarose Gel, 2%, 200 mL
•24 Plastic Reaction Tubes, 0.5 mL
•1 Floating Rack
•1 Bottle WARD’S QUIKView DNA Stain
Concentrate, 60 mL (36 W 8857)
•1 Tube Ethidium Bromide DNA Stain, 50
mL, (10 mg/mL) (36 W 9957)
•1 Amber bottle, 500 mL, labeled for 1X
Ethidium Bromide (36 W 9957)
•1 Biohazard bag (36 W 9957)
•Coupon for perishable material: 2 Hae III
Digest of X174 DNA Marker Standard,
40 mL, 1 PCR Master Mix, 600 mL, 1 PCR
Master Mix, 600 mL, 1 Primer F1, 60 mL
(5’ CAAAAAGAACTTCCTGCCGGAC
3`), 1 Primer F2, 60 mL (5’
GATGAGTTCGTGTCCGTACAAC
3`), 1 Primer F3, 60 mL (5’
ATGAAACTGCCGGTCAGGACAC
3`), 1 Primer R1, 180 mL (5’
GGTTATCGAAATCAGCCACAG 3`), 1
Lambda DNA, 120 mL
Materials Needed But Not Provided
•Electrophoresis Chamber
•Power Supply
•Water Bath or Thermal Cycler
•Micropipets
•Marking Pens
•Timer
•UV Transilluminator (36 W 9957)
•UV Goggles (36 W 9957)
•Ice